band 157 densitometric analysis Search Results


smmc 7721  (ATCC)
96
ATCC smmc 7721
Smmc 7721, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/smmc 7721/product/ATCC
Average 96 stars, based on 1 article reviews
smmc 7721 - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier
mhz bandwidth sxbp 35n  (Mini-Circuits)
92
Mini-Circuits mhz bandwidth sxbp 35n
Mhz Bandwidth Sxbp 35n, supplied by Mini-Circuits, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mhz bandwidth sxbp 35n/product/Mini-Circuits
Average 92 stars, based on 1 article reviews
mhz bandwidth sxbp 35n - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier
gene exp sev mr04269880 mr  (Thermo Fisher)
89
Thermo Fisher gene exp sev mr04269880 mr
Characterization and validation
Gene Exp Sev Mr04269880 Mr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp sev mr04269880 mr/product/Thermo Fisher
Average 89 stars, based on 1 article reviews
gene exp sev mr04269880 mr - by Bioz Stars, 2026-04
89/100 stars
  Buy from Supplier
mdamb 157  (ATCC)
96
ATCC mdamb 157
Characterization and validation
Mdamb 157, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mdamb 157/product/ATCC
Average 96 stars, based on 1 article reviews
mdamb 157 - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier
3t3-l1 cells  (JCRB Cell Bank)
90
JCRB Cell Bank 3t3-l1 cells
Characterization and validation
3t3 L1 Cells, supplied by JCRB Cell Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/3t3-l1 cells/product/JCRB Cell Bank
Average 90 stars, based on 1 article reviews
3t3-l1 cells - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
im-9 myeloma cells  (Korean Cell Line Bank)
90
Korean Cell Line Bank im-9 myeloma cells
Characterization and validation
Im 9 Myeloma Cells, supplied by Korean Cell Line Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/im-9 myeloma cells/product/Korean Cell Line Bank
Average 90 stars, based on 1 article reviews
im-9 myeloma cells - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
enhanced chemiluminescence reagents  (Millipore)
90
Millipore enhanced chemiluminescence reagents
Characterization and validation
Enhanced Chemiluminescence Reagents, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/enhanced chemiluminescence reagents/product/Millipore
Average 90 stars, based on 1 article reviews
enhanced chemiluminescence reagents - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
sequenom autoflex massarray  (Sequenom)
90
Sequenom sequenom autoflex massarray
Genome-wide significant association with keratoconus (data shown in chronological order)
Sequenom Autoflex Massarray, supplied by Sequenom, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequenom autoflex massarray/product/Sequenom
Average 90 stars, based on 1 article reviews
sequenom autoflex massarray - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
sars-cov-2 nucleotide sequences genbank  (GenBase Inc)
90
GenBase Inc sars-cov-2 nucleotide sequences genbank
Genome-wide significant association with keratoconus (data shown in chronological order)
Sars Cov 2 Nucleotide Sequences Genbank, supplied by GenBase Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sars-cov-2 nucleotide sequences genbank/product/GenBase Inc
Average 90 stars, based on 1 article reviews
sars-cov-2 nucleotide sequences genbank - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
molecular center therapeutics laboratory  (DSMZ)
94
DSMZ molecular center therapeutics laboratory
Genome-wide significant association with keratoconus (data shown in chronological order)
Molecular Center Therapeutics Laboratory, supplied by DSMZ, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/molecular center therapeutics laboratory/product/DSMZ
Average 94 stars, based on 1 article reviews
molecular center therapeutics laboratory - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier
mda-mb-231  (Korean Cell Line Bank)
90
Korean Cell Line Bank mda-mb-231
Genome-wide significant association with keratoconus (data shown in chronological order)
Mda Mb 231, supplied by Korean Cell Line Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mda-mb-231/product/Korean Cell Line Bank
Average 90 stars, based on 1 article reviews
mda-mb-231 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
destler, fukui & sato  (Fukui Bank Ltd)
90
Fukui Bank Ltd destler, fukui & sato
Genome-wide significant association with keratoconus (data shown in chronological order)
Destler, Fukui & Sato, supplied by Fukui Bank Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/destler, fukui & sato/product/Fukui Bank Ltd
Average 90 stars, based on 1 article reviews
destler, fukui & sato - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Characterization and validation

Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet: Characterization and validation

Article Snippet: Table 2: Antibodies used for immunocytochemistry/flow cytometry Antibody Dilution Company Cat # RRID Pluripotency Markers Mouse anti-Oct3/4 (C-10) 1:200 Santa Cruz #sc-5297 RRID:AB_628051 Rabbit anti-Nanog (D73G4) 1:400 Cell Signaling #4903S RRID:AB_10559205 Rabbit anti-Sox2 (D6D9) 1:300 Cell Signaling #3579S RRID:AB_2195767 AF488 anti-human SSEA-3 1:50 BioLegend #330306 RRID:AB_1279440 AF647 anti-human SSEA-4 1:400 BioLegend #330408 RRID:AB_1089200 AF488 anti-human Tra-1-60 1:100 BioLegend #330614 RRID:AB_2119064 AF647 anti-human Tra-1-81 1:50 BioLegend #330706 RRID:AB_1089242 Differentiation Markers PE mouse anti-human Sox17 1:25 BD #561591 RRID:AB_10717121 Mouse anti-human FoxA2 1:100 Santa Cruz #sc-101060 RRID:AB_1124660 Rabbit anti-FOXG1 1:300 Abcam #196868 RRID:AB_2892604 AF647 anti-human PAX6 1:20 BD #562249 RRID:AB_2644844 PE/Cyanine7 anti-human CD41 1:400 BioLegend #303718 RRID:AB_10899413 APC Mouse anti-human CD235 1:5000 BD #551336 RRID:AB_398499 Secondary Antibodies Goat anti-mouse IgG2a-AF647 1:400 Jackson Immunoresearch #115-605-206 RRID:AB_2338917 Goat anti-rabbit IgG-AF488 1:400 Jackson Immunoresearch #111-545-144 RRID: AB_2338052 Goat anti-mouse IgG2b-AF488 (flow cytometry) 1:400 Jackson Immunoresearch #115-545-207 RRID:AB_2338856 Goat anti-Mouse IgG (H+L)-AF488 (immunohistochemistry) 1:400 ThermoFisher #A-11029 RRID:AB_2534088 Primers Target Size of band Forward/Reverse primer (5′-3′) Sendai Screening (Taqman qRT-PCR) SEV 59 Mr04269880_mr SEV-KLF4 67 Mr04421256_mr SEV-KOS 80 Mr04421257_mr SEV-cMYC 89 Mr04269876_mr GAPDH 157 Hs02786624_g1 Targeted mutation analysis/sequencing GATA1 Exon 2 screen 387 bp AGATGCAGGAGGGAAAAGAG / CGGCACATCCATTTGAGAAG GATA1 sequencing AAGAGGAGCAGGTGAA Mycoplasma Detection 16S Ribosomal RNA 518 bp CGCCTGAGTAGTACGTTCGC / GCGGTGTGTACAAGACCCGA GAPDH (internal control) 150 bp GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT Open in a separate window Reagents details.

Techniques: Expressing, Flow Cytometry, Mutagenesis, Sequencing, Southern Blot, Virus, Reverse Transcription Polymerase Chain Reaction

Reagents details

Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet: Reagents details

Article Snippet: Table 2: Antibodies used for immunocytochemistry/flow cytometry Antibody Dilution Company Cat # RRID Pluripotency Markers Mouse anti-Oct3/4 (C-10) 1:200 Santa Cruz #sc-5297 RRID:AB_628051 Rabbit anti-Nanog (D73G4) 1:400 Cell Signaling #4903S RRID:AB_10559205 Rabbit anti-Sox2 (D6D9) 1:300 Cell Signaling #3579S RRID:AB_2195767 AF488 anti-human SSEA-3 1:50 BioLegend #330306 RRID:AB_1279440 AF647 anti-human SSEA-4 1:400 BioLegend #330408 RRID:AB_1089200 AF488 anti-human Tra-1-60 1:100 BioLegend #330614 RRID:AB_2119064 AF647 anti-human Tra-1-81 1:50 BioLegend #330706 RRID:AB_1089242 Differentiation Markers PE mouse anti-human Sox17 1:25 BD #561591 RRID:AB_10717121 Mouse anti-human FoxA2 1:100 Santa Cruz #sc-101060 RRID:AB_1124660 Rabbit anti-FOXG1 1:300 Abcam #196868 RRID:AB_2892604 AF647 anti-human PAX6 1:20 BD #562249 RRID:AB_2644844 PE/Cyanine7 anti-human CD41 1:400 BioLegend #303718 RRID:AB_10899413 APC Mouse anti-human CD235 1:5000 BD #551336 RRID:AB_398499 Secondary Antibodies Goat anti-mouse IgG2a-AF647 1:400 Jackson Immunoresearch #115-605-206 RRID:AB_2338917 Goat anti-rabbit IgG-AF488 1:400 Jackson Immunoresearch #111-545-144 RRID: AB_2338052 Goat anti-mouse IgG2b-AF488 (flow cytometry) 1:400 Jackson Immunoresearch #115-545-207 RRID:AB_2338856 Goat anti-Mouse IgG (H+L)-AF488 (immunohistochemistry) 1:400 ThermoFisher #A-11029 RRID:AB_2534088 Primers Target Size of band Forward/Reverse primer (5′-3′) Sendai Screening (Taqman qRT-PCR) SEV 59 Mr04269880_mr SEV-KLF4 67 Mr04421256_mr SEV-KOS 80 Mr04421257_mr SEV-cMYC 89 Mr04269876_mr GAPDH 157 Hs02786624_g1 Targeted mutation analysis/sequencing GATA1 Exon 2 screen 387 bp AGATGCAGGAGGGAAAAGAG / CGGCACATCCATTTGAGAAG GATA1 sequencing AAGAGGAGCAGGTGAA Mycoplasma Detection 16S Ribosomal RNA 518 bp CGCCTGAGTAGTACGTTCGC / GCGGTGTGTACAAGACCCGA GAPDH (internal control) 150 bp GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT Open in a separate window Reagents details.

Techniques: Flow Cytometry, Immunohistochemistry, Mutagenesis, Sequencing, Control

Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet:

Article Snippet: Table 2: Antibodies used for immunocytochemistry/flow cytometry Antibody Dilution Company Cat # RRID Pluripotency Markers Mouse anti-Oct3/4 (C-10) 1:200 Santa Cruz #sc-5297 RRID:AB_628051 Rabbit anti-Nanog (D73G4) 1:400 Cell Signaling #4903S RRID:AB_10559205 Rabbit anti-Sox2 (D6D9) 1:300 Cell Signaling #3579S RRID:AB_2195767 AF488 anti-human SSEA-3 1:50 BioLegend #330306 RRID:AB_1279440 AF647 anti-human SSEA-4 1:400 BioLegend #330408 RRID:AB_1089200 AF488 anti-human Tra-1-60 1:100 BioLegend #330614 RRID:AB_2119064 AF647 anti-human Tra-1-81 1:50 BioLegend #330706 RRID:AB_1089242 Differentiation Markers PE mouse anti-human Sox17 1:25 BD #561591 RRID:AB_10717121 Mouse anti-human FoxA2 1:100 Santa Cruz #sc-101060 RRID:AB_1124660 Rabbit anti-FOXG1 1:300 Abcam #196868 RRID:AB_2892604 AF647 anti-human PAX6 1:20 BD #562249 RRID:AB_2644844 PE/Cyanine7 anti-human CD41 1:400 BioLegend #303718 RRID:AB_10899413 APC Mouse anti-human CD235 1:5000 BD #551336 RRID:AB_398499 Secondary Antibodies Goat anti-mouse IgG2a-AF647 1:400 Jackson Immunoresearch #115-605-206 RRID:AB_2338917 Goat anti-rabbit IgG-AF488 1:400 Jackson Immunoresearch #111-545-144 RRID: AB_2338052 Goat anti-mouse IgG2b-AF488 (flow cytometry) 1:400 Jackson Immunoresearch #115-545-207 RRID:AB_2338856 Goat anti-Mouse IgG (H+L)-AF488 (immunohistochemistry) 1:400 ThermoFisher #A-11029 RRID:AB_2534088 Primers Target Size of band Forward/Reverse primer (5′-3′) Sendai Screening (Taqman qRT-PCR) SEV 59 Mr04269880_mr SEV-KLF4 67 Mr04421256_mr SEV-KOS 80 Mr04421257_mr SEV-cMYC 89 Mr04269876_mr GAPDH 157 Hs02786624_g1 Targeted mutation analysis/sequencing GATA1 Exon 2 screen 387 bp AGATGCAGGAGGGAAAAGAG / CGGCACATCCATTTGAGAAG GATA1 sequencing AAGAGGAGCAGGTGAA Mycoplasma Detection 16S Ribosomal RNA 518 bp CGCCTGAGTAGTACGTTCGC / GCGGTGTGTACAAGACCCGA GAPDH (internal control) 150 bp GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT Open in a separate window Reagents details.

Techniques: Virus, Modification, Mutagenesis

Genome-wide significant association with keratoconus (data shown in chronological order)

Journal: Molecular Genetics and Genomics

Article Title: Genomic strategies to understand causes of keratoconus

doi: 10.1007/s00438-016-1283-z

Figure Lengend Snippet: Genome-wide significant association with keratoconus (data shown in chronological order)

Article Snippet: BANP - ZNF469 , Australian Caucasian , 157/673 , rs9938149 , 0.010 , – , Sequenom Autoflex MassArray , Sahebjada et al. ( ) .

Techniques: Genome Wide, Northern Blot